Need biology help to Make a worksheet about Protein

/in /by

Show the steps taken by an eukaryotic cell to make a protein. Below is a section of the non-template strand of the DNA containing the gene that codes for our desired protein. 

NT: ATAATGCGCATTGGACACACTTGA

1. Write the complementary template strand

2. Transcribe the DNA to RNA using the template strand

3. Where in the cell would transcription take place? 

4. If the RNA produced is mRNA, where in the cell does it go next?

5. To what organelle does it connect with there?

6. Translate the mRNA you obtained in #2 into proteins using the genetic code table shown below.

7. What are proteins consisted of?  

 
Do you need a similar assignment done for you from scratch? We have qualified writers to help you. We assure you an A+ quality paper that is free from plagiarism. Order now for an Amazing Discount!
Use Discount Code "Newclient" for a 15% Discount!

NB: We do not resell papers. Upon ordering, we do an original paper exclusively for you.